Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_5257
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose
Regulog: CelR - Streptomycetaceae
Statistics of regulated genes:
- Genes 14
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -88
Score: 5.7
Sequence: CGATGGGAGCGCTTCCATGC
Locus tag: SAV_5253
Name: bglC2
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglC2
Beta-glucosidase (EC 3.2.1.21)

Position: -69
Score: 5.4
Sequence: CTCTGAGAGCGCTCTCAATT
Locus tag: SAV_1053
Name: SCO7559
Funciton: Putative sugar hydrolase
SCO7559
Putative sugar hydrolase

Position: -102
Score: 5.1
Sequence: TTCAGAGAGCGCTCTCAGAC
Locus tag: SAV_967
Name: SCO0716
Funciton: Putative glycosyl hydrolase
SCO0716
Putative glycosyl hydrolase

Position: -209
Score: 6.3
Sequence: CAGTGGGAGCGCTCCCATAT
Position: -66
Score: 5.1
Sequence: CAGTGGGAGCGATTCCATCA
Locus tag: SAV_1854
Name: celA2
Funciton: Predicted endo-1,4-beta-glucanase
Locus tag: SAV_1853
Name: cbhA
Funciton: 1,4-beta-cellobiohydrolase A (EC 3.2.1.91)
celA2
Predicted endo-1,4-beta-glucanase
cbhA
1,4-beta-cellobiohydrolase A (EC 3.2.1.91)

Position: -60
Score: 5.7
Sequence: TCTTGAGAGCGCTCTCAAGG
Locus tag: SAV_1764
Name: lamA1
Funciton: Predicted endo-1,3-beta-glucanase
lamA1
Predicted endo-1,3-beta-glucanase

Position: 3
Score: 5.9
Sequence: AGGTGGGAGCGCTCCCATAT
Locus tag: SAV_2254
Name: gunA
Funciton: Endoglucanase A (EC 3.2.1.4)
gunA
Endoglucanase A (EC 3.2.1.4)

Position: -218
Score: 5.1
Sequence: TGATGGAATCGCTCCCACTG
Position: -75
Score: 6.3
Sequence: ATATGGGAGCGCTCCCACTG
Locus tag: SAV_1855
Name: cbhB
Funciton: 1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
Locus tag: SAV_1856
Name: celA3
Funciton: Predicted endo-1,4-beta-glucanase
cbhB
1,4-beta-cellobiohydrolase B (EC 3.2.1.91)
celA3
Predicted endo-1,4-beta-glucanase

Position: -134
Score: 6.7
Sequence: TTGTGGGAGCGCTCCCACGG
Locus tag: SAV_5256
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: SAV_5255
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: SAV_5254
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
cebE
Cellobiose specific ABC transporter, substrate-binding protein
cebF
Cellobiose specific ABC transporter, permease protein 1
cebG
Cellobiose specific ABC transporter, permease protein 2

Position: -220
Score: 6.3
Sequence: TTTTGGGAGCGCTCCCAAGA
Position: -75
Score: 5.9
Sequence: GAATGGGAGCGCTCCCACCT
Position: -51
Score: 5.5
Sequence: TGATGGGAGCGCTCCCGAAC
Locus tag: SAV_555
Name: celA1
Funciton: Endoglucanase (EC 3.2.1.4)
celA1
Endoglucanase (EC 3.2.1.4)

Position: -284
Score: 6.7
Sequence: CCGTGGGAGCGCTCCCACAA
Locus tag: SAV_5257
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
celR
Cellobiose utilization transcriptional regulator CelR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD