Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ScrR in Clostridium perfringens ATCC 13124

Properties
Regulator type: Transcription factor
TF locus tag: CPF_1784
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Clostridia-1
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -244
Score: 5.9
Sequence: TTATGAAACTAATTCCATAT
Position: -71
Score: 6.7
Sequence: ATATGGAACTGATACCATAT
Locus tag: CPF_1785
Name: scrA
Funciton: Sucrose specific PTS system, IIABC component (EC 2.7.1.69)
Locus tag: CPF_1784
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
Locus tag: CPF_1783
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: CPF_1782
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
scrA
Sucrose specific PTS system, IIABC component (EC 2.7.1.69)
scrR
Sucrose utilization transcriptional regulator ScrR, LacI family
scrB
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrK
Fructokinase (EC 2.7.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD