Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XCC4129 in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC4129
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: XCC4129 - Xanthomonadales
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -172
Score: 6.5
Sequence: TCATGTAAGCGCTTGCAGTT
Locus tag: XCC4129
Name: XCC4129
Funciton: Transcriptional regulator, LacI family
Locus tag: XCC4131
Name: ompA
Funciton: OmpA-related protein
Locus tag: XCC4132
Name: omp
Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent
Locus tag: XCC4133
Name: prnA
Funciton: tryptophan halogenase
XCC4129
Transcriptional regulator, LacI family
ompA
OmpA-related protein
omp
Putative carbohydrate outer membrane transporter, TonB-dependent
prnA
tryptophan halogenase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD