Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ScrR in Tolumonas auensis DSM 9187

Properties
Regulator type: Transcription factor
TF locus tag: Tola_0813
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -330
Score: 6.1
Sequence: TTGCTAAAACGGTTTAGCGA
Position: -299
Score: 6.3
Sequence: TAGCTAAACCGTTTTAGTAA
Locus tag: Tola_0815
Name: scrA
Funciton: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
Locus tag: Tola_0814
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: Tola_0813
Name: scrR
Funciton: Sucrose operon repressor ScrR, LacI family
scrA
PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
scrB
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrR
Sucrose operon repressor ScrR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD