Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XCC2209 in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC2209
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: XCC2209 - Xanthomonadales
Statistics of regulated genes:
- Genes 12
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -130
Score: 5.8
Sequence: ATGTGAAAACGATTACATGT
Locus tag: XCC2135
Name: ugpC
Funciton: Multiple sugar ABC transporter, ATP-binding protein
ugpC
Multiple sugar ABC transporter, ATP-binding protein

Position: -55
Score: 5.5
Sequence: TCATGAAATCGCTTTCACCT
Locus tag: XCC3510
Name: COG3137
Funciton: Putative salt-induced outer membrane protein
COG3137
Putative salt-induced outer membrane protein

Position: -31
Score: 5.9
Sequence: AGATGTAATCGATTACACGA
Locus tag: XCC2207
Name: COG5368
Funciton: Hypothetical sugar hydrolase
Locus tag: XCC2206
Name: ugpB
Funciton: Sugar ABC transporter, periplasmic sugar-binding protein
Locus tag: XCC2205
Name: ugpA
Funciton: Sugar ABC transporter, sugar permease protein 1
Locus tag: XCC2204
Name: ugpE
Funciton: Sugar ABC transporter, sugar permease protein 2
Locus tag: XCC2203
Name: COG3408
Funciton: Hypothetical sugar binding and hydrolysis protein
COG5368
Hypothetical sugar hydrolase
ugpB
Sugar ABC transporter, periplasmic sugar-binding protein
ugpA
Sugar ABC transporter, sugar permease protein 1
ugpE
Sugar ABC transporter, sugar permease protein 2
COG3408
Hypothetical sugar binding and hydrolysis protein

Position: -27
Score: 5.8
Sequence: CCATGTAAACGTTTTCTCAA
Locus tag: XCC3814
Name: bglX
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglX
Beta-glucosidase (EC 3.2.1.21)

Position: -33
Score: 5.6
Sequence: TCATGTAAACGCTTTCAATC
Locus tag: XCC4223
Name: PF10947
Funciton: hypothetical protein
PF10947
hypothetical protein

Position: -124
Score: 5.1
Sequence: CAGTGGAATCGATTTCAGCA
Locus tag: XCC2469
Name: omp2
Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent
omp2
Putative carbohydrate outer membrane transporter, TonB-dependent

Position: -107
Score: 5.5
Sequence: ATCTGTAAGCGTTTTCACAA
Position: -61
Score: 5.5
Sequence: GTATGAAAACGCTTACAGTC
Locus tag: XCC2209
Name: XCC2209
Funciton: Transcriptional regulator, LacI family
Locus tag: XCC2208
Name: omp
Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent
XCC2209
Transcriptional regulator, LacI family
omp
Putative carbohydrate outer membrane transporter, TonB-dependent
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD