Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ScrR in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type: Transcription factor
TF locus tag: VCA0654
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Vibrionales
Statistics of regulated genes:
- Genes 4
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -128
Score: 6.2
Sequence: TTTTGCAAACGTTCCCGAAA
Locus tag: VCA0653
Name: scrA
Funciton: PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)
scrA
PTS system, sucrose-specific IIB component (EC 2.7.1.69) / PTS system, sucrose-specific IIC component (EC 2.7.1.69)

Position: -192
Score: 6.2
Sequence: TTTCGGGAACGTTTGCAAAA
Locus tag: VCA0654
Name: scrR
Funciton: Sucrose operon repressor ScrR, LacI family
scrR
Sucrose operon repressor ScrR, LacI family

Position: -39
Score: 5.7
Sequence: AATTGAGAACGTTCCCGAAT
Locus tag: VCA0655
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrB
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)

Position: -117
Score: 5.5
Sequence: AATAGGTAACGTTCCCGAAA
Locus tag: VCA0656
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
scrK
Fructokinase (EC 2.7.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD