Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Jann_1459 in Paracoccus denitrificans PD1222

Properties
Regulator type: Transcription factor
TF locus tag: Pden_4766
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Jann_1459 - Rhodobacterales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -62
Score: 4.9
Sequence: GTCTGCAATCGATTGCAAAC
Locus tag: Pden_4766
Name: Jann_1459
Funciton: Transcriptional regulator, LacI family
Jann_1459
Transcriptional regulator, LacI family

Position: -54
Score: 4.9
Sequence: GTTTGCAATCGATTGCAGAC
Locus tag: Pden_4767
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Pden_4768
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: Pden_4769
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: Pden_4770
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: Pden_4771
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
COG1082
Sugar phosphate isomerases/epimerases
COG0673
Predicted dehydrogenases and related proteins
SMb20718
Sugar ABC transport system, ATP-binding protein
SMb20719
SugarABC transport system, inner membrane protein
SMb20720
Sugar ABC transport system, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD