Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Jann_1459 in Oceanicola batsensis HTCC2597

Properties
Regulator type: Transcription factor
TF locus tag: OB2597_08889
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Jann_1459 - Rhodobacterales
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -84
Score: 5.1
Sequence: CCTTGAAATCGATTACATCC
Locus tag: OB2597_08889
Name: Jann_1459
Funciton: Transcriptional regulator, LacI family
Jann_1459
Transcriptional regulator, LacI family

Position: -50
Score: 5.1
Sequence: GGATGTAATCGATTTCAAGG
Locus tag: OB2597_08884
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: OB2597_08879
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: OB2597_08874
Name: null
Funciton: Putative isomerase/epimerase
Locus tag: OB2597_08869
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: OB2597_08864
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08859
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08854
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
COG1082
Sugar phosphate isomerases/epimerases
COG0673
Predicted dehydrogenases and related proteins
Putative isomerase/epimerase
SMb20718
Sugar ABC transport system, ATP-binding protein
SMb20719
SugarABC transport system, inner membrane protein
SMb20719
SugarABC transport system, inner membrane protein
SMb20720
Sugar ABC transport system, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD