Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Jann_1459 in Jannaschia sp. CCS1

Properties
Regulator type: Transcription factor
TF locus tag: Jann_1459
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Jann_1459 - Rhodobacterales
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 5.4
Sequence: CTCTGAAATCGATTACATAC
Locus tag: Jann_1459
Name: Jann_1459
Funciton: Transcriptional regulator, LacI family
Jann_1459
Transcriptional regulator, LacI family

Position: -92
Score: 5.4
Sequence: GTATGTAATCGATTTCAGAG
Locus tag: Jann_1460
Name: null
Funciton: short-chain dehydrogenase/reductase SDR
Locus tag: Jann_1461
Name: Jann_1461
Funciton: oxidoreductase-like
Locus tag: Jann_1462
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: Jann_1463
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
Locus tag: Jann_1464
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: Jann_1465
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1466
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: Jann_1467
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: Jann_1468
Name: null
Funciton: oxidoreductase-like
short-chain dehydrogenase/reductase SDR
Jann_1461
oxidoreductase-like
COG1082
Sugar phosphate isomerases/epimerases
SMb20720
Sugar ABC transport system, substrate-binding protein
SMb20718
Sugar ABC transport system, ATP-binding protein
SMb20719
SugarABC transport system, inner membrane protein
SMb20719
SugarABC transport system, inner membrane protein
COG0673
Predicted dehydrogenases and related proteins
oxidoreductase-like
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD