Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GluR in Caulobacter segnis ATCC 21756

Properties
Regulator type: Transcription factor
TF locus tag: Cseg_1378
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Regulog: GluR - Caulobacterales
Statistics of regulated genes:
- Genes 14
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -34
Score: 6.5
Sequence: TCATGACAACGTTGTCATAG
Locus tag: Cseg_1373
Name: zwf
Funciton: Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
Locus tag: Cseg_1374
Name: pgl
Funciton: 6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
Locus tag: Cseg_1375
Name: edd
Funciton: Phosphogluconate dehydratase (EC 4.2.1.12)
Locus tag: Cseg_1376
Name: glk
Funciton: Glucokinase (EC 2.7.1.2)
zwf
Glucose-6-phosphate 1-dehydrogenase (EC 1.1.1.49)
pgl
6-phosphogluconolactonase (EC 3.1.1.31), eukaryotic type
edd
Phosphogluconate dehydratase (EC 4.2.1.12)
glk
Glucokinase (EC 2.7.1.2)

Position: -219
Score: 4.6
Sequence: TTACGTCAACGTTTTCAGGC
Locus tag: Cseg_1380
Name: pykA
Funciton: Pyruvate kinase (EC 2.7.1.40)
pykA
Pyruvate kinase (EC 2.7.1.40)

Position: -224
Score: 4.4
Sequence: GATGGAAAGCGTTGTCATCG
Locus tag: Cseg_3807
Name: sucC
Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
Locus tag: Cseg_3806
Name: sucD
Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
Locus tag: Cseg_3805
Name: sucA
Funciton: 2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
Locus tag: Cseg_3804
Name: sucB
Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)
sucC
Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5)
sucD
Succinyl-CoA ligase [ADP-forming] alpha chain (EC 6.2.1.5)
sucA
2-oxoglutarate dehydrogenase E1 component (EC 1.2.4.2)
sucB
Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC 2.3.1.61)

Position: -66
Score: 6.3
Sequence: CCATGACAGCCTTGTCATGG
Locus tag: Cseg_1378
Name: gluR
Funciton: Predicted transcriptional regulator for central carbohydrate metabolism, LacI family
gluR
Predicted transcriptional regulator for central carbohydrate metabolism, LacI family

Position: -207
Score: 5.6
Sequence: TTTGGACAACGTTGTCATTG
Locus tag: Cseg_1949
Name: ppdK
Funciton: Pyruvate,phosphate dikinase (EC 2.7.9.1)
ppdK
Pyruvate,phosphate dikinase (EC 2.7.9.1)

Position: -117
Score: 5.4
Sequence: CCGTGACATCGCTGTCATGA
Locus tag: Cseg_2660
Name: gnl
Funciton: Gluconolactonase (EC 3.1.1.17)
Locus tag: Cseg_2659
Name: gfo
Funciton: Glucose--fructose oxidoreductase precursor (EC 1.1.99.28) (GFOR)
Locus tag: Cseg_2658
Name: xylB
Funciton: Endo-1,4-beta-xylanase (EC 3.2.1.8)
gnl
Gluconolactonase (EC 3.1.1.17)
gfo
Glucose--fructose oxidoreductase precursor (EC 1.1.99.28) (GFOR)
xylB
Endo-1,4-beta-xylanase (EC 3.2.1.8)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD