Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Methylibium petroleiphilum PM1

Properties
Regulator type: Transcription factor
TF locus tag: Mpe_A1657
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Comamonadaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -78
Score: 5.4
Sequence: ACCCTGTAGTGGCTACGGACT
Locus tag: Mpe_A2353
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
Locus tag: Mpe_A2354
Name: PF04116
Funciton: Sterol desaturase
Locus tag: Mpe_A2355
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Mpe_A2356
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
pbrT
Pb(II) uptake protein, ILT family
PF04116
Sterol desaturase
czcD
Co/Zn/Cd efflux protein
czcC
Heavy metal efflux RND outer membrane protein

Position: -55
Score: 6
Sequence: ACTCTGGAGCAGCTACAGGGT
Locus tag: Mpe_A1655
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Mpe_A1654
Name: PF01841
Funciton: Transglutaminase-like protein
czcD
Co/Zn/Cd efflux protein
PF01841
Transglutaminase-like protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD