Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Comamonas testosteroni KF-1

Properties
Regulator type: Transcription factor
TF locus tag: CtesDRAFT_2651, CtesDRAFT_1759, CtesDRAFT_0051
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Comamonadaceae
Statistics of regulated genes:
- Genes 7
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -55
Score: 5.8
Sequence: ACTCTATACCAACTACAGGGT
Locus tag: CtesDRAFT_1695
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Position: -61
Score: 6.3
Sequence: ACTCTATAGTAGCTATAGGGT
Locus tag: CtesDRAFT_2650
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: CtesDRAFT_2649
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -44
Score: 6.3
Sequence: ACCCTATAGCTACTATAGAGT
Locus tag: CtesDRAFT_2651
Name: pbrR
Funciton: Lead resistance transcriptional regulator, MerR family
pbrR
Lead resistance transcriptional regulator, MerR family

Position: -150
Score: 4.7
Sequence: ACTCTCAATCTGCTTTAGGGT
Locus tag: CtesDRAFT_1793
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: CtesDRAFT_1792
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -34
Score: 5
Sequence: ACCTTGAAGTGACTTTATTGT
Locus tag: CtesDRAFT_0050
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD