Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Acidovorax sp. JS42

Properties
Regulator type: Transcription factor
TF locus tag: Ajs_1336, Ajs_1241, Ajs_1851, Ajs_2593
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Comamonadaceae
Statistics of regulated genes:
- Genes 9
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -34
Score: 5.5
Sequence: ACTCTATACCCACTTCAGGGT
Locus tag: Ajs_1335
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Ajs_1334
Name: PF01841
Funciton: Transglutaminase-like protein
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
PF01841
Transglutaminase-like protein

Position: -61
Score: 6.3
Sequence: ACTCTATAGTAACTATAGAGT
Locus tag: Ajs_1242
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Ajs_1243
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -54
Score: 6.3
Sequence: ACTCTATAGTTACTATAGAGT
Locus tag: Ajs_1241
Name: pbrR
Funciton: Lead resistance transcriptional regulator, MerR family
Locus tag: Ajs_1240
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
pbrR
Lead resistance transcriptional regulator, MerR family
pbrT
Pb(II) uptake protein, ILT family

Position: -61
Score: 5.2
Sequence: ACATTATAGCTACTATATAGT
Locus tag: Ajs_3474
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Ajs_3473
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD
Co/Zn/Cd efflux protein
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -34
Score: 5.7
Sequence: ACCTTGGAGTGGCTTCAAGGT
Locus tag: Ajs_2594
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD