Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Acinetobacter baumannii AB0057

Properties
Regulator type: Transcription factor
TF locus tag: AB57_1124
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Moraxellaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -61
Score: 5.2
Sequence: ACATTATAGCTACTATATAGT
Locus tag: AB57_0301
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: AB57_0302
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2
Co/Zn/Cd efflux protein
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -57
Score: 5.4
Sequence: ACTCTGGAGCTACTCAAGGGT
Locus tag: AB57_1125
Name: czcD
Funciton: Co/Zn/Cd efflux protein
czcD
Co/Zn/Cd efflux protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD