Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Pseudomonas stutzeri A1501

Properties
Regulator type: Transcription factor
TF locus tag: PST_0663, PST_3417, PST_1620
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -61
Score: 5.9
Sequence: ACCTTGTAGTAGCTATAGGGC
Locus tag: PST_3416
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
czcD2
Co/Zn/Cd efflux protein

Position: -210
Score: 6.2
Sequence: ACCCTGTAGTGGCTTTAGGGT
Locus tag: PST_0664
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Position: -57
Score: 6.6
Sequence: ACCCTGTAGTTGCTACAGGGT
Locus tag: PST_1619
Name: czcD
Funciton: Co/Zn/Cd efflux protein
czcD
Co/Zn/Cd efflux protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD