Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Pseudomonas fluorescens Pf-5

Properties
Regulator type: Transcription factor
TF locus tag: PFL_5893
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -71
Score: 5.8
Sequence: ACCCTATAGCTACTACAGACT
Locus tag: PFL_3147
Name: czcR
Funciton: DNA-binding heavy metal response regulator
Locus tag: PFL_3148
Name: PF00512
Funciton: Heavy metal sensor histidine kinase
czcR
DNA-binding heavy metal response regulator
PF00512
Heavy metal sensor histidine kinase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD