Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Pseudomonas putida KT2440

Properties
Regulator type: Transcription factor
TF locus tag: PP5140
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 6.5
Sequence: ACCCTATAGTGGCTACAGGGT
Locus tag: PP5139
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Position: -56
Score: 5.8
Sequence: ACCCTGATGTCACTACAGGGT
Locus tag: PP1438
Name: czcR
Funciton: DNA-binding heavy metal response regulator
Locus tag: PP1437
Name: PF00512
Funciton: Heavy metal sensor histidine kinase
czcR
DNA-binding heavy metal response regulator
PF00512
Heavy metal sensor histidine kinase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD