Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Ralstonia eutropha JMP134

Properties
Regulator type: Transcription factor
TF locus tag: Reut_A3299
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Ralstonia
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -31
Score: 5.7
Sequence: ACCCCGTAGTCACTACAGAGA
Locus tag: Reut_A3299
Name: cadR
Funciton: Cadmium resistance transcriptional regulator, MerR family
cadR
Cadmium resistance transcriptional regulator, MerR family

Position: -61
Score: 6.3
Sequence: ACTCTGTAGCGGCTACAGGGT
Locus tag: Reut_B3972
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD