Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Ralstonia metallidurans CH34

Properties
Regulator type: Transcription factor
TF locus tag: Rmet_5946, pMOL30_092, Rmet_2302, Rmet_3456
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Ralstonia
Statistics of regulated genes:
- Genes 14
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -26
Score: 4.9
Sequence: ACTCTATATCTACTAGAGGTT
Locus tag: Rmet_2303
Name: pbrA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Rmet_2304
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
pbrA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -63
Score: 6.2
Sequence: ACTCTATAGTAACTAGAGGGT
Locus tag: pMOL30_091
Name: pbrA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: pMOL30_090
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
pbrA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -44
Score: 6.2
Sequence: ACCCTCTAGTTACTATAGAGT
Locus tag: pMOL30_092
Name: pbrR
Funciton: Lead resistance transcriptional regulator, MerR family
Locus tag: pMOL30_093
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
pbrR
Lead resistance transcriptional regulator, MerR family
pbrT
Pb(II) uptake protein, ILT family

Position: -44
Score: 6.2
Sequence: ACCCTCTAGTTACTATAGAGT
Locus tag: Rmet_5946
Name: pbrR
Funciton: Lead resistance transcriptional regulator, MerR family
Locus tag: Rmet_5945
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
pbrR
Lead resistance transcriptional regulator, MerR family
pbrT
Pb(II) uptake protein, ILT family

Position: -63
Score: 6.2
Sequence: ACTCTATAGTAACTAGAGGGT
Locus tag: Rmet_5947
Name: pbrA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Rmet_5948
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
Locus tag: Rmet_5949
Name: pbrD
Funciton: Pb(II) binding protein
pbrA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)
pbrD
Pb(II) binding protein

Position: -30
Score: 5.9
Sequence: ACCCTGTAATTACTACAGGGA
Locus tag: Rmet_3456
Name: cadR
Funciton: Cadmium resistance transcriptional regulator, MerR family
cadR
Cadmium resistance transcriptional regulator, MerR family

Position: -46
Score: 6.1
Sequence: ACCCTGTAGCGACTAAAGGGT
Locus tag: Rmet_4594
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Position: -115
Score: 6
Sequence: ACCCTGTAGTCACTACAGACT
Locus tag: Rmet_5969
Name: Rpic_1752
Funciton: hypothetical protein
Rpic_1752
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD