Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Ralstonia pickettii 12J

Properties
Regulator type: Transcription factor
TF locus tag: Rpic_1642, Rpic_1816, Rpic_4808
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Ralstonia
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -43
Score: 6.2
Sequence: ACTCTATAGCTACTATAGAGT
Locus tag: Rpic_1642
Name: pbrR
Funciton: Lead resistance transcriptional regulator, MerR family
Locus tag: Rpic_1641
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
pbrR
Lead resistance transcriptional regulator, MerR family
pbrT
Pb(II) uptake protein, ILT family

Position: -43
Score: 6.2
Sequence: ACTCTATAGCTACTATAGAGT
Locus tag: Rpic_1816
Name: pbrR
Funciton: Lead resistance transcriptional regulator, MerR family
Locus tag: Rpic_1817
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
pbrR
Lead resistance transcriptional regulator, MerR family
pbrT
Pb(II) uptake protein, ILT family

Position: -34
Score: 5.6
Sequence: ACCCTGGAGCTTCTTCAGGGT
Locus tag: Rpic_4809
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Position: -115
Score: 6
Sequence: ACCCTGTAGTCACTACAGACT
Locus tag: Rpic_1752
Name: Rpic_1752
Funciton: hypothetical protein
Rpic_1752
hypothetical protein

Position: -65
Score: 6.2
Sequence: ACTCTATAGTAGCTATAGAGT
Locus tag: Rpic_1643
Name: pbrA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Rpic_1644
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
pbrA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -63
Score: 6.2
Sequence: ACTCTATAGTAGCTATAGAGT
Locus tag: Rpic_1815
Name: pbrA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Rpic_1814
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
pbrA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD