Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Shewanella sp ANA-3

Properties
Regulator type: Transcription factor
TF locus tag: Shewana3_4323, Shewana3_4158
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Shewanellaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -57
Score: 6.3
Sequence: ACTCTATAGTAACTATAGAGT
Locus tag: Shewana3_4157
Name: czcD
Funciton: Co/Zn/Cd efflux protein
czcD
Co/Zn/Cd efflux protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD