Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Shewanella sp W3-18-1

Properties
Regulator type: Transcription factor
TF locus tag: Sputw3181_0521, Sputw3181_0438, Sputw3181_0413, Sputw3181_1170
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Shewanellaceae
Statistics of regulated genes:
- Genes 11
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -61
Score: 5.6
Sequence: ACCTTATAGTGACTTTATAGT
Locus tag: Sputw3181_0414
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputw3181_0415
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2
Co/Zn/Cd efflux protein
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -61
Score: 5.6
Sequence: ACCTTATAGTGACTTTATAGT
Locus tag: Sputw3181_0439
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputw3181_0440
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2
Co/Zn/Cd efflux protein
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -59
Score: 6.4
Sequence: ACTCTATAGTAACTACAGAGT
Locus tag: Sputw3181_1169
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputw3181_1168
Name: null
Funciton: hypothetical protein
Locus tag: Sputw3181_1167
Name: czcC
Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: Sputw3181_1166
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sputw3181_1165
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
czcD
Co/Zn/Cd efflux protein
hypothetical protein
czcC
Heavy metal RND efflux outer membrane protein
czcB
Heavy metal efflux RND transporter, membrane fusion protein
czcA
Heavy metal efflux RND transmembrane protein

Position: -61
Score: 5.6
Sequence: ACCTTATAGTGACTTTATAGT
Locus tag: Sputw3181_0520
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputw3181_0519
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2
Co/Zn/Cd efflux protein
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD