Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CadR-PbrR in Shewanella putrefaciens CN-32

Properties
Regulator type: Transcription factor
TF locus tag: Sputcn32_0220, Sputcn32_0194, Sputcn32_1973, Sputcn32_0230
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Shewanellaceae
Statistics of regulated genes:
- Genes 16
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -59
Score: 6.4
Sequence: ACTCTATAGTAACTACAGAGT
Locus tag: Sputcn32_1972
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputcn32_1971
Name: null
Funciton: hypothetical protein
Locus tag: Sputcn32_1970
Name: czcC
Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: Sputcn32_1969
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sputcn32_1968
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
Locus tag: Sputcn32_1967
Name: null
Funciton: hypothetical protein
Locus tag: Sputcn32_1966
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
czcD
Co/Zn/Cd efflux protein
hypothetical protein
czcC
Heavy metal RND efflux outer membrane protein
czcB
Heavy metal efflux RND transporter, membrane fusion protein
czcA
Heavy metal efflux RND transmembrane protein
hypothetical protein
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Position: -59
Score: 6.4
Sequence: ACTCTATAGTAACTACAGAGT
Locus tag: Sputcn32_0229
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputcn32_0228
Name: null
Funciton: hypothetical protein
Locus tag: Sputcn32_0227
Name: czcC
Funciton: Heavy metal RND efflux outer membrane protein
Locus tag: Sputcn32_0226
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sputcn32_0225
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
czcD
Co/Zn/Cd efflux protein
hypothetical protein
czcC
Heavy metal RND efflux outer membrane protein
czcB
Heavy metal efflux RND transporter, membrane fusion protein
czcA
Heavy metal efflux RND transmembrane protein

Position: -61
Score: 5.6
Sequence: ACCTTATAGTGACTTTATAGT
Locus tag: Sputcn32_0195
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputcn32_0196
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2
Co/Zn/Cd efflux protein
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)

Position: -61
Score: 5.6
Sequence: ACCTTATAGTGACTTTATAGT
Locus tag: Sputcn32_0221
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sputcn32_0222
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2
Co/Zn/Cd efflux protein
lspA
Lipoprotein signal peptidase (EC 3.4.23.36)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD