Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MerR in Polaromonas sp. JS666

Properties
Regulator type: Transcription factor
TF locus tag: Bpro_4798, Bpro_2232
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Comamonadaceae
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -34
Score: 6.7
Sequence: ACTCCGTACTTAAGTACGGAAG
Locus tag: Bpro_4797
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: Bpro_4796
Name: merP
Funciton: Periplasmic mercury (+2) binding protein
merT
Mercury uptake inner membane protein
merP
Periplasmic mercury (+2) binding protein

Position: -63
Score: 6.1
Sequence: ACTCCGTACATTACTACGGAAA
Locus tag: Bpro_2231
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: Bpro_2230
Name: merP
Funciton: Periplasmic mercury (+2) binding protein
Locus tag: Bpro_2229
Name: merC
Funciton: Mercury uptake inner membane protein
Locus tag: Bpro_2228
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
Locus tag: Bpro_2227
Name: merD
Funciton: Mercuric resistance operon coregulator
Locus tag: Bpro_2226
Name: merE
Funciton: Putative mercury resistance protein
merT
Mercury uptake inner membane protein
merP
Periplasmic mercury (+2) binding protein
merC
Mercury uptake inner membane protein
merA
Mercuric ion reductase (EC 1.16.1.1)
merD
Mercuric resistance operon coregulator
merE
Putative mercury resistance protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD