Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MerR in Delftia acidovorans SPH-1

Properties
Regulator type: Transcription factor
TF locus tag: Daci_0486
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Regulog: MerR - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -63
Score: 6.2
Sequence: ACTCCGTAGTTGACTACGGAAG
Locus tag: Daci_0485
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: Daci_0484
Name: merP
Funciton: Periplasmic mercury (+2) binding protein
Locus tag: Daci_0483
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
merT
Mercury uptake inner membane protein
merP
Periplasmic mercury (+2) binding protein
merA
Mercuric ion reductase (EC 1.16.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD