Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CueR in Acinetobacter baumannii AB0057

Properties
Regulator type: Transcription factor
TF locus tag: AB57_1354
Regulator family: MerR
Regulation mode: activator
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Moraxellaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -121
Score: 5.4
Sequence: ACCTTGTCATGATTGTAAGGT
Position: -70
Score: 5.6
Sequence: ACCTTCCCATGATGGGAATCT
Locus tag: AB57_1353
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: AB57_1354
Name: cueR
Funciton: Copper resistance ranscriptional regulator, MerR family
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
Copper resistance ranscriptional regulator, MerR family

Position: -123
Score: 5.6
Sequence: AGATTCCCATCATGGGAAGGT
Position: -72
Score: 5.4
Sequence: ACCTTACAATCATGACAAGGT
Locus tag: AB57_1352
Name: copZ
Funciton: Copper chaperone
copZ
Copper chaperone
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD