Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SoxR in Variovorax paradoxus S110

Properties
Regulator type: Transcription factor
TF locus tag: Vapar_4431
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Regulog: SoxR - Comamonadaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -32
Score: 6.3
Sequence: ACCTCAACTAAAGTCGAGGT
Locus tag: Vapar_4431
Name: soxR
Funciton: Redox-sensitive transcriptional activator, MerR family
soxR
Redox-sensitive transcriptional activator, MerR family

Position: -35
Score: 6.2
Sequence: ACCTCAAGTTAGGTTGAGGC
Locus tag: Vapar_4430
Name: null
Funciton: hypothetical protein
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD