Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SoxR in Delftia acidovorans SPH-1

Properties
Regulator type: Transcription factor
TF locus tag: Daci_1189
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Regulog: SoxR - Comamonadaceae
Statistics of regulated genes:
- Genes 4
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -45
Score: 5.6
Sequence: ATCTCAACCGCACTTGAGGT
Locus tag: Daci_3895
Name: PF07690
Funciton: Permease of the major facilitator superfamily
PF07690
Permease of the major facilitator superfamily

Position: -77
Score: 6.5
Sequence: ACCTCAACTTTGGTTGAGGT
Locus tag: Daci_1188
Name: PF01042
Funciton: Endoribonuclease L-PSP
Locus tag: Daci_1187
Name: PF07690
Funciton: Permease of the major facilitator superfamily
PF01042
Endoribonuclease L-PSP
PF07690
Permease of the major facilitator superfamily

Position: -72
Score: 6.5
Sequence: ACCTCAACCAAAGTTGAGGT
Locus tag: Daci_1189
Name: soxR
Funciton: Redox-sensitive transcriptional activator, MerR family
soxR
Redox-sensitive transcriptional activator, MerR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD