Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SoxR in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type: Transcription factor
TF locus tag: Aave_2276
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Regulog: SoxR - Comamonadaceae
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -185
Score: 5.9
Sequence: ACCTCAACAATGGTTGAGGT
Locus tag: Aave_1362
Name: mexE
Funciton: RND transporter, membrane fusion protein
Locus tag: Aave_1363
Name: mexF
Funciton: RND transporter, membrane fusion protein
Locus tag: Aave_1364
Name: oprN
Funciton: RND transporter, outer membrane protein
mexE
RND transporter, membrane fusion protein
mexF
RND transporter, membrane fusion protein
oprN
RND transporter, outer membrane protein

Position: -61
Score: 6.7
Sequence: ACCTCAACTAAACTTGAGGT
Locus tag: Aave_2276
Name: soxR
Funciton: Redox-sensitive transcriptional activator, MerR family
soxR
Redox-sensitive transcriptional activator, MerR family

Position: -85
Score: 6.7
Sequence: ACCTCAAGTTTAGTTGAGGT
Locus tag: Aave_2275
Name: PF01042
Funciton: Endoribonuclease L-PSP
Locus tag: Aave_2274
Name: PF07690
Funciton: Permease of the major facilitator superfamily
PF01042
Endoribonuclease L-PSP
PF07690
Permease of the major facilitator superfamily
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD