Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SoxR in Stenotrophomonas maltophilia K279a

Properties
Regulator type: Transcription factor
TF locus tag: Smlt1084
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Regulog: SoxR - Xanthomonadales
Statistics of regulated genes:
- Genes 10
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -55
Score: 5.8
Sequence: ACCTCAACCGGGGTTGAGGT
Locus tag: Smlt2940
Name: PF01042
Funciton: Endoribonuclease L-PSP
PF01042
Endoribonuclease L-PSP

Position: -140
Score: 5.8
Sequence: ACCTCGACCATGGTTGAGGT
Locus tag: Smlt1830
Name: mexE
Funciton: RND transporter, membrane fusion protein
Locus tag: Smlt1831
Name: mexF
Funciton: RND transporter, membrane fusion protein
Locus tag: Smlt1832
Name: PF00106
Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
Locus tag: Smlt1833
Name: oprN
Funciton: RND transporter, outer membrane protein
mexE
RND transporter, membrane fusion protein
mexF
RND transporter, membrane fusion protein
PF00106
oxidoreductase, short-chain dehydrogenase/reductase family
oprN
RND transporter, outer membrane protein

Position: -76
Score: 6.1
Sequence: ACCTCAACCAATGTTGAGGT
Locus tag: Smlt2828
Name: sodA
Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
Locus tag: Smlt2829
Name: PF01613
Funciton: Putative flavin reductase
Locus tag: Smlt2830
Name: null
Funciton: Tetratricopeptide repeat protein
sodA
Manganese superoxide dismutase (EC 1.15.1.1)
PF01613
Putative flavin reductase
Tetratricopeptide repeat protein

Position: -23
Score: 6.3
Sequence: ACCTCAACTGCAGTTGAGGT
Locus tag: Smlt1083
Name: PF07690
Funciton: Permease of the major facilitator superfamily
PF07690
Permease of the major facilitator superfamily

Position: -26
Score: 6.3
Sequence: ACCTCAACTGCAGTTGAGGT
Locus tag: Smlt1084
Name: soxR
Funciton: Redox-sensitive transcriptional activator, MerR family
soxR
Redox-sensitive transcriptional activator, MerR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD