Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SoxR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type: Transcription factor
TF locus tag: XAC3000
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Regulog: SoxR - Xanthomonadales
Statistics of regulated genes:
- Genes 3
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -92
Score: 6.2
Sequence: ACCTCAACTTAGGTTGAGGC
Locus tag: XAC3001
Name: PF07690
Funciton: Permease of the major facilitator superfamily
PF07690
Permease of the major facilitator superfamily

Position: -54
Score: 6.1
Sequence: ACCTCAACTGCGCTTGAGGT
Locus tag: XAC0314
Name: null
Funciton: Oxidative stress resistance protein
Oxidative stress resistance protein

Position: -27
Score: 6.2
Sequence: GCCTCAACCTAAGTTGAGGT
Locus tag: XAC3000
Name: soxR
Funciton: Redox-sensitive transcriptional activator, MerR family
soxR
Redox-sensitive transcriptional activator, MerR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD