Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SoxR in Acinetobacter baumannii AB0057

Properties
Regulator type: Transcription factor
TF locus tag: AB57_1503
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Regulog: SoxR - Moraxellaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -58
Score: 6.8
Sequence: ACCTCAACTTAAGTTGAGGT
Locus tag: AB57_0668
Name: PF01042
Funciton: Endoribonuclease L-PSP
Locus tag: AB57_0667
Name: PF07690
Funciton: Permease of the major facilitator superfamily
PF01042
Endoribonuclease L-PSP
PF07690
Permease of the major facilitator superfamily
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD