Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR2 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type: Transcription factor
TF locus tag: pRL90226
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR2 - Rhizobiales
Statistics of regulated genes:
- Genes 9
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -44
Score: 6.2
Sequence: CTTGTAAAGCGCTTTACTAA
Position: -31
Score: 6
Sequence: TTACTAAACCGCTTTACAAT
Locus tag: pRL90226
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: pRL90225
Name: rbsA
Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
Locus tag: pRL90224
Name: rbsB
Funciton: Ribose ABC transporter, ATP-binding protein rbsB
Locus tag: pRL90223
Name: rbsC
Funciton: Ribose ABC transporter, inner membrane protein rbsC
Locus tag: pRL90222
Name: COG1735
Funciton: phosphotriesterase-like protein
Locus tag: pRL90221
Name: COG5426
Funciton: Uncharacterized membrane protein
Locus tag: pRL90220
Name: SSF51366
Funciton: Ribulose-phosphate binding barrel
Locus tag: pRL90219
Name: tenA
Funciton: Thiaminase II (EC 3.5.99.2)
Locus tag: pRL90218
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsR2
Transcriptional repressor of ribose utilization, LacI family
rbsA
Ribose ABC transporter, periplasmic ribose-binding protein rbsA
rbsB
Ribose ABC transporter, ATP-binding protein rbsB
rbsC
Ribose ABC transporter, inner membrane protein rbsC
COG1735
phosphotriesterase-like protein
COG5426
Uncharacterized membrane protein
SSF51366
Ribulose-phosphate binding barrel
tenA
Thiaminase II (EC 3.5.99.2)
rbsK
Ribokinase (EC 2.7.1.15)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD