Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR2 in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type: Transcription factor
TF locus tag: Atu3062
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR2 - Rhizobiales
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -86
Score: 6.3
Sequence: CTTGTAAACCGGTTTAGTAA
Position: -73
Score: 6.2
Sequence: TTAGTAAATCGCTTTACAAA
Locus tag: Atu3062
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: Atu3063
Name: rbsA
Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
Locus tag: Atu3064
Name: rbsB
Funciton: Ribose ABC transporter, ATP-binding protein rbsB
Locus tag: Atu3065
Name: rbsC
Funciton: Ribose ABC transporter, inner membrane protein rbsC
Locus tag: Atu3066
Name: COG1735
Funciton: phosphotriesterase-like protein
Locus tag: Atu3067
Name: COG5426
Funciton: Uncharacterized membrane protein
rbsR2
Transcriptional repressor of ribose utilization, LacI family
rbsA
Ribose ABC transporter, periplasmic ribose-binding protein rbsA
rbsB
Ribose ABC transporter, ATP-binding protein rbsB
rbsC
Ribose ABC transporter, inner membrane protein rbsC
COG1735
phosphotriesterase-like protein
COG5426
Uncharacterized membrane protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD