Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type: Transcription factor
TF locus tag: XAC2037
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Xanthomonadales
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -113
Score: 6.2
Sequence: GATATAGCAGTTGCTATGCT
Locus tag: XAC2037
Name: mntR
Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
mntR
Manganese homeostasis transcriptional regulator MntR, DtxR family

Position: -49
Score: 6.2
Sequence: AGCATAGCAACTGCTATATC
Locus tag: XAC2036
Name: mntH
Funciton: Manganese transporter, NRAMP family
mntH
Manganese transporter, NRAMP family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD