Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GntR in Leptothrix cholodnii SP-6

Properties
Regulator type: Transcription factor
TF locus tag: Lcho_0328
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Comamonadaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -170
Score: 6
Sequence: TTTGGATAGCGCTATCTCGT
Position: -61
Score: 6.6
Sequence: TTTGGATAGCGCTATCCTAG
Locus tag: Lcho_0328
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntR
Gluconate utilization transcriptional regulator GntR, LacI family

Position: -128
Score: 6.6
Sequence: CTAGGATAGCGCTATCCAAA
Position: -19
Score: 6
Sequence: ACGAGATAGCGCTATCCAAA
Locus tag: Lcho_0327
Name: gntK
Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
gntK
Thermoresistant gluconokinase (EC 2.7.1.12)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD