Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GntR in Variovorax paradoxus S110

Properties
Regulator type: Transcription factor
TF locus tag: Vapar_6141
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -145
Score: 5.8
Sequence: CAGGGATAGCGCTATCCCGC
Position: -70
Score: 6.1
Sequence: CTGGGACAGCGCTATCCTAG
Position: -54
Score: 5.7
Sequence: CTAGGACAGCGCTGTCCAAT
Locus tag: Vapar_6141
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntR
Gluconate utilization transcriptional regulator GntR, LacI family

Position: -157
Score: 5.7
Sequence: ATTGGACAGCGCTGTCCTAG
Position: -141
Score: 6.1
Sequence: CTAGGATAGCGCTGTCCCAG
Position: -66
Score: 5.8
Sequence: GCGGGATAGCGCTATCCCTG
Locus tag: Vapar_6142
Name: gntT
Funciton: High-affinity H+/gluconate symporter
Locus tag: Vapar_6143
Name: gntK3
Funciton: Gluconokinase, Firmicutes type (EC 2.7.1.12)
gntT
High-affinity H+/gluconate symporter
gntK3
Gluconokinase, Firmicutes type (EC 2.7.1.12)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD