Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GntR in Polaromonas naphthalenivorans CJ2

Properties
Regulator type: Transcription factor
TF locus tag: Pnap_0047
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Comamonadaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -140
Score: 6.5
Sequence: ATAGGATAGCGCTATCCCAA
Position: -30
Score: 6.1
Sequence: AACGGATAGCGCTATCCAAG
Locus tag: Pnap_0046
Name: gntK
Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: Pnap_0045
Name: gntY
Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: Pnap_0044
Name: gntZ
Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: Pnap_0043
Name: gntX
Funciton: Predicted gluconate TRAP family transporter, DctP subunit
gntK
Thermoresistant gluconokinase (EC 2.7.1.12)
gntY
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
Predicted gluconate TRAP family transporter, DctM subunit
gntX
Predicted gluconate TRAP family transporter, DctP subunit

Position: -128
Score: 6.1
Sequence: CTTGGATAGCGCTATCCGTT
Locus tag: Pnap_0047
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntR
Gluconate utilization transcriptional regulator GntR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD