Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GntR in Delftia acidovorans SPH-1

Properties
Regulator type: Transcription factor
TF locus tag: Daci_3760
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Comamonadaceae
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -175
Score: 6.2
Sequence: TTGGGATAGCGCTATCCATG
Position: -56
Score: 6.3
Sequence: TTGGGATAGCGCTATCATAA
Locus tag: Daci_3760
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntR
Gluconate utilization transcriptional regulator GntR, LacI family

Position: -120
Score: 6.3
Sequence: TTATGATAGCGCTATCCCAA
Locus tag: Daci_3761
Name: gntK
Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: Daci_3762
Name: gntY
Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: Daci_3763
Name: gntZ
Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: Daci_3764
Name: gntX
Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: Daci_3765
Name: edd
Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12)
Locus tag: Daci_3766
Name: eda
Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
gntK
Thermoresistant gluconokinase (EC 2.7.1.12)
gntY
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
Predicted gluconate TRAP family transporter, DctM subunit
gntX
Predicted gluconate TRAP family transporter, DctP subunit
edd
6-phosphogluconate dehydratase (EC 4.2.1.12)
eda
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD