Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GntR in Comamonas testosteroni KF-1

Properties
Regulator type: Transcription factor
TF locus tag: CtesDRAFT_0562
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Comamonadaceae
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -147
Score: 6
Sequence: TTATGATAGCGCTATCCGGA
Position: -21
Score: 6.3
Sequence: ATCGGATAGCGCTATCCAAA
Locus tag: CtesDRAFT_0561
Name: gntK
Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: CtesDRAFT_0560
Name: gntY
Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: CtesDRAFT_0559
Name: gntZ
Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: CtesDRAFT_0558
Name: gntX
Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: CtesDRAFT_0557
Name: edd
Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12)
Locus tag: CtesDRAFT_0556
Name: eda
Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
gntK
Thermoresistant gluconokinase (EC 2.7.1.12)
gntY
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
Predicted gluconate TRAP family transporter, DctM subunit
gntX
Predicted gluconate TRAP family transporter, DctP subunit
edd
6-phosphogluconate dehydratase (EC 4.2.1.12)
eda
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)

Position: -181
Score: 6.3
Sequence: TTTGGATAGCGCTATCCGAT
Position: -55
Score: 6
Sequence: TCCGGATAGCGCTATCATAA
Locus tag: CtesDRAFT_0562
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntR
Gluconate utilization transcriptional regulator GntR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD