Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GntR in Acidovorax sp. JS42

Properties
Regulator type: Transcription factor
TF locus tag: Ajs_2054
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Comamonadaceae
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -180
Score: 6
Sequence: TTAAGATAGCGCTATCTTTC
Locus tag: Ajs_2053
Name: gntK
Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: Ajs_2052
Name: gntY
Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: Ajs_2051
Name: gntZ
Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: Ajs_2050
Name: gntX
Funciton: Predicted gluconate TRAP family transporter, DctP subunit
Locus tag: Ajs_2049
Name: edd
Funciton: 6-phosphogluconate dehydratase (EC 4.2.1.12)
Locus tag: Ajs_2048
Name: eda
Funciton: 2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)
gntK
Thermoresistant gluconokinase (EC 2.7.1.12)
gntY
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
Predicted gluconate TRAP family transporter, DctM subunit
gntX
Predicted gluconate TRAP family transporter, DctP subunit
edd
6-phosphogluconate dehydratase (EC 4.2.1.12)
eda
2-keto-3-deoxygluconate 6-phosphate aldolase (EC 4.1.2.14)

Position: -219
Score: 6
Sequence: TCAAGATAGCGCTATCTTTA
Position: -55
Score: 6
Sequence: GAAAGATAGCGCTATCTTAA
Locus tag: Ajs_2054
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntR
Gluconate utilization transcriptional regulator GntR, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD