Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GntR in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type: Transcription factor
TF locus tag: Aave_2798
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Comamonadaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -172
Score: 6.1
Sequence: CTTGGATAGCGCTATCCGTT
Position: -55
Score: 6.1
Sequence: GCAAGATAGCGCTATCCTAG
Locus tag: Aave_2798
Name: gntR
Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
gntR
Gluconate utilization transcriptional regulator GntR, LacI family

Position: -109
Score: 6.1
Sequence: CTAGGATAGCGCTATCTTGC
Locus tag: Aave_2797
Name: gntK
Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
Locus tag: Aave_2796
Name: gntY
Funciton: Predicted gluconate TRAP family transporter, DctQ subunit
Locus tag: Aave_2795
Name: gntZ
Funciton: Predicted gluconate TRAP family transporter, DctM subunit
Locus tag: Aave_2794
Name: gntX
Funciton: Predicted gluconate TRAP family transporter, DctP subunit
gntK
Thermoresistant gluconokinase (EC 2.7.1.12)
gntY
Predicted gluconate TRAP family transporter, DctQ subunit
gntZ
Predicted gluconate TRAP family transporter, DctM subunit
gntX
Predicted gluconate TRAP family transporter, DctP subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD