Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Rhodoferax ferrireducens DSM 15236

Properties
Regulator type: Transcription factor
TF locus tag: Rfer_1650
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -130
Score: 7.2
Sequence: TTAGCACTCGTAAGAGTTGAGTGCTAA
Locus tag: Rfer_1132
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Rfer_1131
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -58
Score: 7.1
Sequence: TTAGCACTCTCTCTCATAGAGTGCTAA
Locus tag: Rfer_1692
Name: rpoH
Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
rpoH
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD