Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AglR in Rhodobacterales bacterium HTCC2654

Properties
Regulator type: Transcription factor
TF locus tag: RB2654_03744
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Sucrose; Trehalose
Regulog: AglR - Rhodobacterales
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -170
Score: 5.6
Sequence: GCTCCAAACCGTTTTGGATG
Locus tag: RB2654_03744
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
Locus tag: RB2654_03749
Name: RSP_2874
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: RB2654_03754
Name: glk
Funciton: Glucokinase (EC 2.7.1.2)
aglR
Transcriptional regulator of alpha-glucoside utilization, LacI family
RSP_2874
Beta-glucosidase (EC 3.2.1.21)
glk
Glucokinase (EC 2.7.1.2)

Position: -97
Score: 5.6
Sequence: CATCCAAAACGGTTTGGAGC
Locus tag: RB2654_03739
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: RB2654_03734
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RB2654_03729
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RB2654_03724
Name: aglA
Funciton: Alpha-glucosidase AglA
Locus tag: RB2654_03719
Name: aglK
Funciton: Alpha-glucoside ABC transporter ATP-binding protein
aglE
Alpha-glucoside ABC transporter periplasmic sugar-binding protein
aglF
Alpha-glucoside ABC transporter permease protein
aglG
Alpha-glucoside ABC transporter permease protein
aglA
Alpha-glucosidase AglA
aglK
Alpha-glucoside ABC transporter ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD