Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AglR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type: Transcription factor
TF locus tag: RL0744
Regulator family: LacI
Regulation mode: repressor
Biological process: Alpha-glucosides utilization
Effector: Alpha-glucoside; Maltose; Trehalose; Sucrose
Regulog: AglR - Rhizobiales
Statistics of regulated genes:
- Genes 8
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -245
Score: 5.9
Sequence: CATCCAAAGCGCTTTCAATT
Position: -73
Score: 6.3
Sequence: GGGTCAAAGCGCTTTGAAAT
Locus tag: RL0745
Name: aglE
Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein
Locus tag: RL0746
Name: aglF
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RL0747
Name: aglG
Funciton: Alpha-glucoside ABC transporter permease protein
Locus tag: RL0748
Name: aglA
Funciton: Alpha-glucosidase AglA
Locus tag: RL0749
Name: aglK
Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE
Alpha-glucoside ABC transporter periplasmic sugar-binding protein
aglF
Alpha-glucoside ABC transporter permease protein
aglG
Alpha-glucoside ABC transporter permease protein
aglA
Alpha-glucosidase AglA
aglK
Alpha-glucoside transport ATP-binding protein AglK

Position: -256
Score: 6.3
Sequence: ATTTCAAAGCGCTTTGACCC
Position: -84
Score: 5.9
Sequence: AATTGAAAGCGCTTTGGATG
Locus tag: RL0744
Name: aglR
Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
aglR
Transcriptional regulator of alpha-glucoside utilization, LacI family

Position: -66
Score: 6.2
Sequence: TTTCCAAAGCGCTTTGAATC
Locus tag: RL3686
Name: thuA
Funciton: Trehalose utilization protein
Locus tag: RL3685
Name: null
Funciton: Oxidoreductase (EC 1.1.1.-)
thuA
Trehalose utilization protein
Oxidoreductase (EC 1.1.1.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD