Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of DVU0309 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type: Transcription factor
TF locus tag: DVU0309
Regulator family: LysR
Regulation mode:
Biological process:
Effector:
Regulog: DVU0309 - Desulfovibrionales
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -85
Score: 5.7
Sequence: TCCATCTGTTTTTCAGATAGA
Position: -52
Score: 5.1
Sequence: TCAATCCGTCTTCCAGATAGA
Locus tag: DVU0308
Name: COG4125
Funciton: membrane protein, putative
COG4125
membrane protein, putative

Position: -61
Score: 5.1
Sequence: TCTATCTGGAAGACGGATTGA
Position: -28
Score: 5.7
Sequence: TCTATCTGAAAAACAGATGGA
Locus tag: DVU0309
Name: null
Funciton: transcriptional regulator, LysR family
transcriptional regulator, LysR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD