Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of DVU0309 in Desulfohalobium retbaense DSM 5692

Properties
Regulator type: Transcription factor
TF locus tag: Dret_0355
Regulator family: LysR
Regulation mode:
Biological process:
Effector:
Regulog: DVU0309 - Desulfovibrionales
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -184
Score: 5.3
Sequence: CCTATCAGAAATTTTGATAGC
Locus tag: Dret_0354
Name: null
Funciton: peptidase M24
peptidase M24

Position: -418
Score: 5.3
Sequence: GCTATCAAAATTTCTGATAGG
Locus tag: Dret_0355
Name: null
Funciton: transcriptional regulator, LysR family
transcriptional regulator, LysR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD