Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_1157 in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type: Transcription factor
TF locus tag: Haur_0297
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: Caur_1157 - Chloroflexia
Statistics of regulated genes:
- Genes 10
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -207
Score: 5.7
Sequence: GCTTGGGAGCGATCTCATTC
Position: -131
Score: 6
Sequence: CATTGGGAGCGGTCTCAATG
Locus tag: Haur_0296
Name: bglA
Funciton: Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)
Locus tag: Haur_0295
Name: null
Funciton: Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A)
Locus tag: Haur_0294
Name: null
Funciton: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
Locus tag: Haur_0293
Name: null
Funciton: Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
bglA
Endoglucanase B precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase B) (Cellulase B)
Endoglucanase A precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase A) (Cellulase A)
Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)
Endoglucanase 2 precursor (EC 3.2.1.4) (Endo-1,4-beta-glucanase 2) (Cellulase 2)

Position: -347
Score: 6
Sequence: CATTGAGACCGCTCCCAATG
Position: -271
Score: 5.7
Sequence: GAATGAGATCGCTCCCAAGC
Locus tag: Haur_0297
Name: Caur_1157
Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Haur_0298
Name: Haur_0298
Funciton: Sugar ABC transport system, sugar-binding protein
Locus tag: Haur_0299
Name: null
Funciton: Sugar ABC transporter permease
Locus tag: Haur_0300
Name: Haur_0300
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Haur_0301
Name: null
Funciton: hypothetical protein
Caur_1157
Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Haur_0298
Sugar ABC transport system, sugar-binding protein
Sugar ABC transporter permease
Haur_0300
binding-protein-dependent transport systems inner membrane component
hypothetical protein

Position: -41
Score: 5.2
Sequence: TATTGAGACCGATTCCAATG
Locus tag: Haur_1418
Name: null
Funciton: Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)
Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD