Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_1157 in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_1181
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: Caur_1157 - Chloroflexia
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -117
Score: 5.6
Sequence: GACTGGAAGCGCTTTCACGG
Locus tag: Chy400_1181
Name: Caur_1157
Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Chy400_1180
Name: null
Funciton: extracellular solute-binding protein family 1
Locus tag: Chy400_1179
Name: null
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Chy400_1178
Name: null
Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Chy400_1177
Name: null
Funciton: glycoside hydrolase family 3 domain protein
Locus tag: Chy400_1176
Name: null
Funciton: glycoside hydrolase family 16
Locus tag: Chy400_1175
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Caur_1157
Predicted transcriptional regulator for beta-glucoside utilization, LacI family
extracellular solute-binding protein family 1
binding-protein-dependent transport systems inner membrane component
binding-protein-dependent transport systems inner membrane component
glycoside hydrolase family 3 domain protein
glycoside hydrolase family 16
bglB
Beta-glucosidase (EC 3.2.1.21)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD