Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FlpA in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type: Transcription factor
TF locus tag: L0239
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Regulog: FlpA - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 5.8
Sequence: TTCTTGATGGCTATCAATTT
Locus tag: L63697
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
Locus tag: L0239
Name: flpA
Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
flpA
Heavy metal resistance transcriptional regulator FlpA, Crp family

Position: -88
Score: 5.7
Sequence: TTCTTGATGTAAATCAATGT
Locus tag: L134080
Name: copZ
Funciton: Copper chaperone
copZ
Copper chaperone
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD